nucleofector ii system (Amaxa)
86
Structured Review
Amaxa
nucleofector ii system
Nucleofector Ii System, supplied by Amaxa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nucleofector+ii/amaxa+ii+nucleofector+system/pm42155771-215-7-10
Average 86 stars, based on 1 article reviews
Nucleofector Ii System, supplied by Amaxa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nucleofector+ii/amaxa+ii+nucleofector+system/pm42155771-215-7-10
Average 86 stars, based on 1 article reviews
nucleofector ii system - by Bioz Stars,
2026-09
86/100 stars
Images
Related Articles
Electroporation:Article Title: Cell-type-specific functionality encoded within the intrinsically disordered regions of OCT4. Article Snippet: The ssDNA sequence used as a template for HDR is shown below: Pou5f1-lin29-42_homology_50bp: TCTCACCCCCACCAGGTGGGG GTGATGGGTCAGCAGGGCTGGAGCCGGGCggCggaggCagcggaggCgga agcGGTGGGCCTGGAATCGGACCAGGCTCAGAGGTATTGGGGATCTC CCCATG For each reaction, 7 × 105 freshly harvested mES cells were resuspended in 90 μl pre-warmed mES cell Nucleofector® mixture (20 μL Supplement per 90 μL Nucleofector® Solution) (#VPH1001, Lonza Biosciences). .. The cell suspensions were transferred to Amaxa-certified cuvettes, and electroporation was performed using the Article Title: Septin crosstalk with microtubules and actin is regulated by a GSK3-dependent phosphoswitch Article Snippet: .. Primary neurons were electroporated immediately prior to plating using Article Title: Cell-type-specific functionality encoded within the intrinsically disordered regions of OCT4 Article Snippet: The ssDNA sequence used as a template for HDR is shown below: Pou5f1-lin29-42_homology_50bp: TCTCACCCCCACCAGGTGGGGGTGATGGGTCAGCAGGGCTGGAGCCGGGCggCggaggCagcggaggCggaagcGGTGGGCCTGGAATCGGACCAGGCTCAGAGGTATTGGGGATCTCCCCATG For each reaction, 7 × 10 5 freshly harvested mES cells were resuspended in 90 μl pre-warmed mES cell Nucleofector ® mixture (20 μL Supplement per 90 μL Nucleofector® Solution) (#VPH1001, Lonza Biosciences). .. The cell suspensions were transferred to Amaxa-certified cuvettes, and electroporation was performed using the Clone Assay:Article Title: A human CAGinSTEM platform for decoding HTT repeats’ somatic instability links CAG interruption to HD pathology in neurons Article Snippet: .. To generate the entire platform, 2 × 106 cells of the RMCE-H9 parental clones (#01, #04, #25) were nucleofected with 1 μg of pUC57_HDR_RMCE plasmid carrying a specific exon1 variant and 1 μg of pCAG-Cre:GFP (Addgene) by using Nucleofector kit (Lonza), in Plasmid Preparation:Article Title: A human CAGinSTEM platform for decoding HTT repeats’ somatic instability links CAG interruption to HD pathology in neurons Article Snippet: .. To generate the entire platform, 2 × 106 cells of the RMCE-H9 parental clones (#01, #04, #25) were nucleofected with 1 μg of pUC57_HDR_RMCE plasmid carrying a specific exon1 variant and 1 μg of pCAG-Cre:GFP (Addgene) by using Nucleofector kit (Lonza), in Variant Assay:Article Title: A human CAGinSTEM platform for decoding HTT repeats’ somatic instability links CAG interruption to HD pathology in neurons Article Snippet: .. To generate the entire platform, 2 × 106 cells of the RMCE-H9 parental clones (#01, #04, #25) were nucleofected with 1 μg of pUC57_HDR_RMCE plasmid carrying a specific exon1 variant and 1 μg of pCAG-Cre:GFP (Addgene) by using Nucleofector kit (Lonza), in |