Review




Structured Review

Amaxa nucleofector ii system
Nucleofector Ii System, supplied by Amaxa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nucleofector+ii/amaxa+ii+nucleofector+system/pm42155771-215-7-10
Average 86 stars, based on 1 article reviews
nucleofector ii system - by Bioz Stars, 2026-09
86/100 stars

Images

Related Articles

Electroporation:

Article Title: Cell-type-specific functionality encoded within the intrinsically disordered regions of OCT4.
Article Snippet: The ssDNA sequence used as a template for HDR is shown below: Pou5f1-lin29-42_homology_50bp: TCTCACCCCCACCAGGTGGGG GTGATGGGTCAGCAGGGCTGGAGCCGGGCggCggaggCagcggaggCgga agcGGTGGGCCTGGAATCGGACCAGGCTCAGAGGTATTGGGGATCTC CCCATG For each reaction, 7 × 105 freshly harvested mES cells were resuspended in 90 μl pre-warmed mES cell Nucleofector® mixture (20 μL Supplement per 90 μL Nucleofector® Solution) (#VPH1001, Lonza Biosciences). .. The cell suspensions were transferred to Amaxa-certified cuvettes, and electroporation was performed using the Nucleofector® II (Amaxa) program A-30/A-030 (Lonza Biosciences). ..

Article Title: Septin crosstalk with microtubules and actin is regulated by a GSK3-dependent phosphoswitch
Article Snippet: .. Primary neurons were electroporated immediately prior to plating using Nucleofector II (Amaxa) with Ingenio Electroporation Kits and Solution (Mirus Bio). .. Cells were maintained in Neurobasal Medium with 1X B27 and 1X GlutaMAX supplements (ThermoFisher Scientific) and incubated at 37°C with 5% CO2.

Article Title: Cell-type-specific functionality encoded within the intrinsically disordered regions of OCT4
Article Snippet: The ssDNA sequence used as a template for HDR is shown below: Pou5f1-lin29-42_homology_50bp: TCTCACCCCCACCAGGTGGGGGTGATGGGTCAGCAGGGCTGGAGCCGGGCggCggaggCagcggaggCggaagcGGTGGGCCTGGAATCGGACCAGGCTCAGAGGTATTGGGGATCTCCCCATG For each reaction, 7 × 10 5 freshly harvested mES cells were resuspended in 90 μl pre-warmed mES cell Nucleofector ® mixture (20 μL Supplement per 90 μL Nucleofector® Solution) (#VPH1001, Lonza Biosciences). .. The cell suspensions were transferred to Amaxa-certified cuvettes, and electroporation was performed using the Nucleofector® II (Amaxa) program A-30/A-030 (Lonza Biosciences). ..

Clone Assay:

Article Title: A human CAGinSTEM platform for decoding HTT repeats’ somatic instability links CAG interruption to HD pathology in neurons
Article Snippet: .. To generate the entire platform, 2 × 106 cells of the RMCE-H9 parental clones (#01, #04, #25) were nucleofected with 1 μg of pUC57_HDR_RMCE plasmid carrying a specific exon1 variant and 1 μg of pCAG-Cre:GFP (Addgene) by using Nucleofector kit (Lonza), in Nucleofector II (Amaxa biosystems) using the B-016 program. ..

Plasmid Preparation:

Article Title: A human CAGinSTEM platform for decoding HTT repeats’ somatic instability links CAG interruption to HD pathology in neurons
Article Snippet: .. To generate the entire platform, 2 × 106 cells of the RMCE-H9 parental clones (#01, #04, #25) were nucleofected with 1 μg of pUC57_HDR_RMCE plasmid carrying a specific exon1 variant and 1 μg of pCAG-Cre:GFP (Addgene) by using Nucleofector kit (Lonza), in Nucleofector II (Amaxa biosystems) using the B-016 program. ..

Variant Assay:

Article Title: A human CAGinSTEM platform for decoding HTT repeats’ somatic instability links CAG interruption to HD pathology in neurons
Article Snippet: .. To generate the entire platform, 2 × 106 cells of the RMCE-H9 parental clones (#01, #04, #25) were nucleofected with 1 μg of pUC57_HDR_RMCE plasmid carrying a specific exon1 variant and 1 μg of pCAG-Cre:GFP (Addgene) by using Nucleofector kit (Lonza), in Nucleofector II (Amaxa biosystems) using the B-016 program. ..



Similar Products

86
Amaxa nucleofector ii system
Nucleofector Ii System, supplied by Amaxa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nucleofector+ii/amaxa+ii+nucleofector+system/pm42155771-215-7-10
Average 86 stars, based on 1 article reviews
nucleofector ii system - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Amaxa nucleofector ii
Nucleofector Ii, supplied by Amaxa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nucleofector+ii/amaxa+ii+nucleofector/bio_rxiv__64898__2026__05__12__724483-343-6-8
Average 86 stars, based on 1 article reviews
nucleofector ii - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Amaxa amaxa nucleofector ii
Amaxa Nucleofector Ii, supplied by Amaxa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nucleofector+ii/amaxa+ii+nucleofector/pm41951731-527-10-10
Average 86 stars, based on 1 article reviews
amaxa nucleofector ii - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

Image Search Results